Your privacy, your choice

We use essential cookies to make sure the site can function. We also use optional cookies for advertising, personalisation of content, usage analysis, and social media.

By accepting optional cookies, you consent to the processing of your personal data - including transfers to third parties. Some third parties are outside of the European Economic Area, with varying standards of data protection.

See our privacy policy for more information on the use of your personal data.

for further information and to change your choices.

Skip to main content

Table 2 Customized gene specific assay for HERV-FXA34 expression

From: DNA methylation status classifies pleural mesothelioma cells according to their immune profile: implication for precision epigenetic therapy

Accession Number

Assay ID

Target Sequence

ERV-FXA34 (U29659.1)

APRWNMA

CTCCATTAGTAGCAGTTCCTCTCCCTACCCCCTTTAATTATACTATAAATTCATCAACCCCTATACCACCGGTCCCAAAAGGACAGGTCCCACTATTCTCAGACCCTATAAGACATAAGTTCCCATTCTGTTACTCTACCCCAAATGCCTCTTGGTGTAACCAGACTAGGATGCTTACCAGCACCCCGGCACCGCCCAGGGCTACTTCTGGTGTAACTCCACGCTAACTAAAGTTCTTAACTCAACTGGTAATCACACCTTGTGCTTACCCATCTCTCTCATCCCTGGCCTGACCCTATATAGTCAGGATGAACTTAGCCATCTGCTAGCCTGGACCGAGCCAAGGCCACAAAATAAAAGCAAATGGGCTATTTT